Stem-loop sequence ath-MIR5645e

AccessionMI0019257 (change log)
DescriptionArabidopsis thaliana miR5645e stem-loop
Gene family MIPF0001280; MIR5645
Stem-loop
                  a         u           a                         -a   cc    g    guu  c      cucc   a          a   ca          caucucguuuugucuguugaaacaaauuuaaacccuaaauccccaaaucgauuucauuaucugcgauuuugaggucagguggg 
5' uaaaugacaaaguuu uguugacuu ucauuugaguc ugucguuaaguagguuaauauaauu  uuu  cggc uuaa   cu guuuau    ucu uuagaacaaa caa  uuguuuauug                                                                                   u
   ||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||||||  |||  |||| ||||   || ||||||    ||| |||||||||| |||  ||||||||||                                                                                   u
3' auuuacuguuucaaa acaacugaa gguaaacucag auagcaauuuauccaauuauauuaa  aaa  gccg aauu   ga caaaua    aga aaucuuguuu guu  agcaaauaac                                                                                   u
                  a         c           g                         aa   au    a    acu  a      aacu   c          -   ac          uucuguguuuugcugcagcaaaacagagaacuuuguuuauauuuggaauuuagggauauagcuaaaguaauagaguuuuagug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 5321227-5321643 [+]
intergenic
Database links

Mature sequence ath-miR5645e

Accession MIMAT0022446
Sequence

29 - 

auuugagucaugucguuaag

 - 48

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).