Stem-loop sequence gma-MIR2111a

AccessionMI0019269 (change log)
Previous IDsgma-MIR2111
DescriptionGlycine max miR2111 stem-loop
Gene family MIPF0000754; MIR2111
Literature search

5 open access papers mention gma-MIR2111a
(28 sentences)

Stem-loop
   ---au      gucc   uu g             ug   u      -   uauc 
5'      ugcugg    gga  a guaaucugcaucc  agg uuagga caa    c
        ||||||    |||  | |||||||||||||  ||| |||||| |||    u
3'      acgacc    ccu  u cauuagacguagg  ucc gaucuu guu    u
   auguc      -guu   uc g             gu   u      u   uugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 33084345-33084452 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR2111a
gma-MIR2111achr1: 33084345-33084452 [+]
gma-MIR10197chr1: 33086656-33086756 [+]
Database links

Mature sequence gma-miR2111a

Accession MIMAT0022457
Previous IDsgma-miR2111
Sequence

68 - 

guccuugggaugcagauuacg

 - 88

Get sequence
Evidence experimental; Illumina [1], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).