Stem-loop sequence gma-MIR4387e

AccessionMI0019276 (change log)
DescriptionGlycine max miR4387e stem-loop
Gene family MIPF0001109; MIR4387
Literature search

2 open access papers mention gma-MIR4387e
(2 sentences)

Stem-loop
   --acaa    agu                 a           a          ---a    u 
5'       augg   guuauauuaucacgccu aucacugacgc ucauugucac    ucau g
         ||||   ||||||||||||||||| ||||||||||| ||||||||||    |||| a
3'       uauu   uaguguaguagugcgga uagugauugug aguaacagug    agug a
   cuacua    guu                 a           g          cgga    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 23234500-23234621 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR4387e
gma-MIR4399chr3: 23233443-23233593 [+]
gma-MIR4387echr3: 23234500-23234621 [+]
Database links

Mature sequence gma-miR4387e

Accession MIMAT0022464
Sequence

82 - 

uguuagugauaaggcgugaug

 - 102

Get sequence
Evidence experimental; Illumina [1], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).