Stem-loop sequence ola-let-7b-1

AccessionMI0019431 (change log)
DescriptionOryzias latipes let-7b-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ola-let-7b-1
(14 sentences)

   cgua     u                     ucaggguaguuauu 
5'     cgggg gagguaguagguugugugguu              u
       ||||| |||||||||||||||||||||              u
3'     guccc uuccgucauccaacauaucaa              g
   -gaa     -                     uagaggacuaaccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
6: 6147325-6147415 [+]
ENSORLT00000026190 ; ola-let-7b-1-201; exon 1
Clustered miRNAs
< 10kb from ola-let-7b-1
ola-let-7a-16: 6146863-6146961 [+]
ola-let-7b-16: 6147325-6147415 [+]
Database links

Mature sequence ola-let-7b

Accession MIMAT0022551

10 - 


 - 30

Get sequence
Evidence experimental; SOLiD [1]


PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).