Stem-loop sequence ola-let-7g

AccessionMI0019441 (change log)
DescriptionOryzias latipes let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ola-let-7g
(12 sentences)

Stem-loop
      -         u   gu     u          ----uua     ac 
5' cgu gcuguggga gag  aguag uuguauaguu       ggauc  a
   ||| ||||||||| |||  ||||| ||||||||||       |||||   
3' gca cgauauucu uuc  ucauc gacauaucaa       ucuag  c
      a         -   ug     u          uagaggg     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
7: 11992087-11992180 [+]
intergenic
Database links

Mature sequence ola-let-7g

Accession MIMAT0022563
Sequence

13 - 

ugagguaguaguuuguauag

 - 32

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).