Stem-loop sequence ola-mir-128

AccessionMI0019482 (change log)
DescriptionOryzias latipes miR-128 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   aag c  ugu        ag          uua      ca     g ac 
5'    g gc   ggcaguag  gagggggccg   cacugu  gagau u  u
      | ||   ||||||||  ||||||||||   ||||||  ||||| |  c
3'    c ug   ucgucguc  uuucucuggc   gugaca  cucug g  u
   -ug u  ucu        cu          caa      --     g ag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
11: 21614207-21614306 [-]
intergenic
Database links

Mature sequence ola-miR-128

Accession MIMAT0022601
Sequence

61 - 

ucacagugaaccggucucuu

 - 80

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).