Stem-loop sequence ola-let-7b-2

AccessionMI0019550 (change log)
DescriptionOryzias latipes let-7b-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ola-let-7b-2
(14 sentences)

   ua     u                     ---  -----a    ugu 
5'   caggg gagguaguagguugugugguu   uc      gggu   g
     ||||| |||||||||||||||||||||   ||      ||||   a
3'   guccc uuccgucauccaacauaucaa   ag      ccca   u
   ag     -                     ucg  gaauac    uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
23: 6185677-6185764 [-]
ENSORLT00000026196 ; ola-let-7b-2-201; exon 1
Clustered miRNAs
< 10kb from ola-let-7b-2
ola-let-7a-323: 6186600-6186694 [-]
ola-let-7b-223: 6185677-6185764 [-]
Database links

Mature sequence ola-let-7b

Accession MIMAT0022551

8 - 


 - 28

Get sequence
Evidence experimental; SOLiD [1]


PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).