Stem-loop sequence ola-let-7a-3

AccessionMI0019551 (change log)
DescriptionOryzias latipes let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ola-let-7a-3
(27 sentences)

Stem-loop
   ac   -   ug   u   gu                uuagggucauuc 
5'   guc cuu  ggg gag  aguagguuguauaguu            c
     ||| |||  ||| |||  ||||||||||||||||             
3'   cgg gaa  ccu uuc  ucauucaacauaucag            c
   -u   c   gu   -   ug                uagacugucgua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
23: 6186600-6186694 [-]
sense
ENSORLT00000025911 ; ola-let-7a-3-201; exon 1
Clustered miRNAs
< 10kb from ola-let-7a-3
ola-let-7a-323: 6186600-6186694 [-]
ola-let-7b-223: 6185677-6185764 [-]
Database links

Mature sequence ola-let-7a

Accession MIMAT0022566
Sequence

14 - 

ugagguaguagguuguauaguu

 - 35

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).