Stem-loop sequence dre-mir-132-3

AccessionMI0019581
DescriptionDanio rerio miR-132-3 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       uuccuc      --------    a  c           u            gua    u 
5' uccc      ugcugu        cucc ug ugaccguggcu uagauuguuacu   gcgu g
   ||||      ||||||        |||| || ||||||||||| ||||||||||||   ||||  
3' aggg      gcgaca        gggg ac gcugguaccga aucugacaaugg   ugca g
       ucauca      uuguggac    a  c           c            ---    c 
Get sequence
Deep sequencing
2 reads, 1.68 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 36850202-36850320 [+]
antisense
ENSDART00000109345 ; ovca2-201; intron 1
Clustered miRNAs
< 10kb from dre-mir-132-3
dre-mir-132-310: 36850202-36850320 [+]
dre-mir-218410: 36859430-36859539 [-]

Mature sequence dre-miR-132-3p

Accession MIMAT0001829
Previous IDsdre-miR-132
Sequence

66 - 

uaacagucuacagccauggucg

 - 87

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).