Dead miRNA entry

miRNA accession:
MI0019581
miRNA ID:
dre-mir-132-3
Forward to:
MI0001991
Comment:
The sequences previously named mir-132-2 and mir-132-3 map to the same locus in the GRCz10 genome assembly. The entries are therefore merged.

Previous miRNA entry

Stem-loop sequence dre-mir-132-3

AccessionMI0019581 (change log)
DescriptionDanio rerio miR-132-3 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       uuccuc      --------    a  c           u            gua    u 
5' uccc      ugcugu        cucc ug ugaccguggcu uagauuguuacu   gcgu g
   ||||      ||||||        |||| || ||||||||||| ||||||||||||   ||||  
3' aggg      gcgaca        gggg ac gcugguaccga aucugacaaugg   ugca g
       ucauca      uuguggac    a  c           c            ---    c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dre-miR-132-3p

Accession MIMAT0001829
Previous IDsdre-miR-132
Sequence

66 - 

uaacagucuacagccauggucg

 - 87

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).