Dead miRNA entry

miRNA accession:
MI0019582
miRNA ID:
dre-mir-137-3
Forward to:
MI0002001
Comment:
The sequences previously named mir-137-2 and mir-137-3 map to the same locus in the GRCz10 genome assembly. The entries are therefore merged.

Previous miRNA entry

Stem-loop sequence dre-mir-137-3

AccessionMI0019582 (change log)
DescriptionDanio rerio miR-137-3 stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
        g    uu  cu uauaaag            ug   g           ug a     -  g 
5' guucu uugu  cc  c       gacucucuucgg  acg guauucuuggg  g uaaua cg c
   ||||| ||||  ||  |       ||||||||||||  ||| |||||||||||  | ||||| || u
3' cgaga agcg  gg  g       cugagaggagcu  ugc cauaagaauuc  u auugu gc c
        g    gc  cu -----ua            ga   g           gu -     u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dre-miR-137-5p

Accession MIMAT0031972
Sequence

39 - 

acggguauucuuggguggauaaua

 - 62

Get sequence
Deep sequencing1252 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-137-3p

Accession MIMAT0001834
Previous IDsdre-miR-137
Sequence

75 - 

uuauugcuuaagaauacgcgua

 - 96

Get sequence
Deep sequencing6196 reads, 9 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).