Dead miRNA entry

miRNA accession:
MI0019591
miRNA ID:
dre-mir-23a-4
Forward to:
MI0001915
Comment:
The sequences previously named mir-23a-2 and mir-23a-4 map to the same locus in the GRCz10 genome assembly. The entries are therefore merged.

Previous miRNA entry

Stem-loop sequence dre-mir-23a-4

AccessionMI0019591 (change log)
DescriptionDanio rerio miR-23a-4 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
       ---  -   c     -g               a       uuaaac 
5' cucu   uc ugc ggcca  gggaauuccuggcag gugauuu      c
   ||||   || ||| |||||  ||||||||||||||| |||||||      u
3' gaga   ag gug ucggu  ccuuuagggaccguu cacuaag      a
       cuc  u   c     aa               a       ucagua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dre-miR-23a-5p

Accession MIMAT0031944
Sequence

19 - 

gaauuccuggcagagugauuu

 - 39

Get sequence
Evidence not experimental

Mature sequence dre-miR-23a-3p

Accession MIMAT0001790
Previous IDsdre-miR-23a
Sequence

57 - 

aucacauugccagggauuucca

 - 78

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).