Dead miRNA entry

miRNA accession:
MI0019592
miRNA ID:
dre-mir-24-5
Forward to:
MI0001919
Comment:
The sequences previously named mir-24-2 and mir-24-5 map to the same locus in the GRCz10 genome assembly. The entries are therefore merged.

Previous miRNA entry

Stem-loop sequence dre-mir-24-5

AccessionMI0019592 (change log)
DescriptionDanio rerio miR-24-5 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
   g   ug u       g       u     uaa     g ac 
5'  ggc  g cuccugu ccugcug gcuga   ucagu g  g
    |||  | ||||||| ||||||| |||||   ||||| |  g
3'  cug  c ggggaca ggacgac ugacu   gguca u  c
   -   gu c       a       u     --c     g gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dre-miR-24

Accession MIMAT0001792
Sequence

51 - 

uggcucaguucagcaggaacag

 - 72

Get sequence
Deep sequencing85524 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).