Stem-loop sequence gma-MIR399a

AccessionMI0019739 (change log)
DescriptionGlycine max miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

15 open access papers mention gma-MIR399a
(116 sentences)

Stem-loop
   aaaac   u       uu     ua         aau    a   cca 
5'      agc auagggc  cucuu  uuggcagga   uauc uga   c
        ||| |||||||  |||||  |||||||||   |||| |||    
3'      ucg ugucccg  gagag  aaccguucu   auag acu   u
   uuuca   u       uu     ga         ---    -   acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 46844955-46845048 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399a
gma-MIR399achr10: 46844955-46845048 [+]
gma-MIR399mchr10: 46849030-46849140 [+]
Database links

Mature sequence gma-miR399a

Accession MIMAT0023194
Sequence

64 - 

ugccaaaggagaguugcccug

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).