Stem-loop sequence osa-MIR5826

AccessionMI0019845 (change log)
DescriptionOryza sativa miR5826 stem-loop
Literature search

1 open access papers mention osa-MIR5826
(1 sentences)

Stem-loop
   ac         a                 a         a    c    u     uuuuuuuucuc   cua       -----       cuccccugcucucucucucucucucucauguucuuccucccacuccucucucuccuguuuugguuugagccucaacgugaug 
5'   uaggggcua ccacucuuuucacuuug gcuaggaau cuug aagg guugu           cuc   gaccugu     ucuuccu                                                                                  g
     ||||||||| ||||||||||||||||| ||||||||| |||| |||| |||||           |||   |||||||     |||||||                                                                                   
3'   auccccgau ggugagaagagugaaac cgauccuua gaac uucu caacg           gag   cuggaca     agaagga                                                                                  u
   uu         g                 c         a    a    u     ----------u   -ac       caaga       acucaagaggaaggggaaagacaggugguaguaccaccccgucuucaaaguaggguacucgacugcguuuguccucuacgag 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 12858909-12859240 [+]
intergenic
Database links

Mature sequence osa-miR5826

Accession MIMAT0023300
Sequence

299 - 

uagcccaaagugagaagagugggu

 - 322

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).