Stem-loop sequence hco-mir-50

AccessionMI0020005 (change log)
DescriptionHaemonchus contortus miR-50 stem-loop
Gene family MIPF0000266; mir-50
Literature search

2 open access papers mention hco-mir-50
(12 sentences)

Stem-loop
   ----uuccacaa    -     uag  c              -    ug    c g 
5'             uggc ugcuu   cu ugauaugucuggua uucu  gguu a u
               |||| |||||   || |||||||||||||| ||||  |||| |  
3'             accg gcgag   ga gcuauacagauuau aaga  ccaa u g
   gucgucaucacc    u     cua  a              c    --    - a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-50

Accession MIMAT0023329
Sequence

24 - 

ugauaugucugguauucuuggg

 - 45

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).