Stem-loop sequence hco-mir-45

AccessionMI0020015 (change log)
DescriptionHaemonchus contortus miR-45 stem-loop
Gene family MIPF0000132; mir-44
Literature search

2 open access papers mention hco-mir-45
(2 sentences)

Stem-loop
   ----   --cuca     cauu u    u        u     g       c  g 
5'     cac      gucac    g ccga cuggaugu ucucu agucaua uc u
       |||      |||||    | |||| |||||||| ||||| ||||||| || u
3'     gug      cagug    c gguu gacuuaca agaga ucaguau ag g
   aucg   cuauac     -cau -    c        c     -       -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-45

Accession MIMAT0023339
Sequence

58 - 

ugacuagagacacauucagcu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).