Stem-loop sequence hco-lin-4

AccessionMI0020020 (change log)
DescriptionHaemonchus contortus lin-4 stem-loop
Literature search

2 open access papers mention hco-lin-4
(5 sentences)

Stem-loop
   ucuu   --ucga     -au    cuc      ac u     -    -  gc 
5'     ucc      ucacu   ccug   ccugag  c caauu gcga cu  u
       |||      |||||   ||||   ||||||  | ||||| |||| ||   
3'     ggg      agugg   ggac   ggacuc  g guuaa cgcu ga  a
   -ugu   ucaaac     cgc    aua      ca u     g    a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-lin-4

Accession MIMAT0023345
Sequence

24 - 

ucccugagaccucaauugcga

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).