Stem-loop sequence hco-mir-84a

AccessionMI0020041 (change log)
DescriptionHaemonchus contortus miR-84 stem-loop
Literature search

2 open access papers mention hco-mir-84a
(2 sentences)

Stem-loop
   ----ua  gcug      g  c    c        uuu            uuu 
5'       ga    agcuca ug acag ugagguag   uaaauguuauga   u
         ||    |||||| || |||| ||||||||   ||||||||||||   a
3'       cu    uugagu ac uguc gcuucauc   auuuacaauacu   u
   ucaguc  -aua      -  u    u        -cu            ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-84a

Accession MIMAT0023368
Sequence

24 - 

ugagguaguuuuaaauguuauga

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).