Stem-loop sequence hco-mir-5960

AccessionMI0020132 (change log)
DescriptionHaemonchus contortus miR-5960 stem-loop
Literature search

1 open access papers mention hco-mir-5960
(9 sentences)

Stem-loop
   ------------------    ugau      uacuucu   g     c  ----a         uu  cuguuga    c 
5'                   augc    gacgua       ugu ugguc gg     gucggaggg  au       uccc u
                     ||||    ||||||       ||| ||||| ||     |||||||||  ||       ||||  
3'                   uacg    uuguau       aca gccag uc     cggcuuccc  ua       aggg c
   cguuuuuuugccacuuuu    --uu      -------   -     c  aaaca         uu  -------    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5960

Accession MIMAT0023464
Sequence

25 - 

gugguccggagucggaggguuau

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).