Stem-loop sequence sly-MIR6026

AccessionMI0020257 (change log)
DescriptionSolanum lycopersicum miR6026 stem-loop
Gene family MIPF0001554; MIR6026
Literature search

5 open access papers mention sly-MIR6026
(18 sentences)

Stem-loop
   ---------      g                a         c    cu c                u          uug         u      auuucucuaaacuuguuuuucguugaac 
5'          cacuuu auuugguaauacaacu uagccaaga aaug  u auuauaagugcauaac uuucacuuua   uuugagcau guguug                            a
            |||||| |||||||||||||||| ||||||||| ||||  | |||||||||||||||| ||||||||||   ||||||||| ||||||                             
3'          gugaag ugaaccguuauguuga aucgguucu uuau  a uaguguuuacguauug aaagugagau   agacucgug cacaac                            a
   guuaauuuu      -                g         u    au u                u          uga         c      gaaagguacucauauacuuuuuuguuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr1: 832340-832581 [+]
intergenic
Database links

Mature sequence sly-miR6026

Accession MIMAT0023610
Sequence

201 - 

uucuuggcuagaguuguauugc

 - 222

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).