Stem-loop sequence ame-mir-92c

AccessionMI0020315 (change log)
DescriptionApis mellifera miR-92c stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention ame-mir-92c
(1 sentences)

Stem-loop
   ---    a ug             u g   uu     uug aa 
5'    ggau c  gcagguugggaug g gca  auuug   c  g
      |||| |  ||||||||||||| | |||  |||||   |  g
3'    ucua g  cguccggcccugc c cgu  uaaac   g  u
   uga    - gu             u a   --     -ua au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 8056244-8056325 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-92c
ame-mir-92aCM000066.5: 8056052-8056151 [+]
ame-mir-92cCM000066.5: 8056244-8056325 [+]
Database links

Mature sequence ame-miR-92c-5p

Accession MIMAT0023668
Sequence

11 - 

agguugggaugugggcauuauuug

 - 34

Get sequence
Evidence experimental; Illumina [1,3]

Mature sequence ame-miR-92c-3p

Accession MIMAT0037455
Sequence

52 - 

auugcacucgucccggccu

 - 70

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).