Stem-loop sequence cgr-let-7a-1

AccessionMI0020368 (change log)
DescriptionCricetulus griseus let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ----------    g     u   gu                uuagggucacac 
5'           cacu uggga gag  aguagguuguauaguu            c
             |||| ||||| |||  ||||||||||||||||            c
3'           gugg auccu uuc  ucaucuaacauaucaa            a
   ugaaaaggua    a     -   ug                uagagggucacc 
Get sequence
Deep sequencing
25567134 reads, 3.52e+05 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000030.1: 3831224-3831323 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-let-7a-1
cgr-let-7a-1JH000030.1: 3831224-3831323 [-]
cgr-let-7fJH000030.1: 3830872-3830971 [-]
cgr-let-7dJH000030.1: 3829137-3829231 [-]
Database links

Mature sequence cgr-let-7a

Accession MIMAT0023716
Sequence

11 - 

ugagguaguagguuguauaguu

 - 32

Get sequence
Deep sequencing25534414 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).