Stem-loop sequence cgr-let-7b

AccessionMI0020369 (change log)
DescriptionCricetulus griseus let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention cgr-let-7b
(1 sentences)

Stem-loop
   ---------a  g     u                     ----  ---a      u 
5'           cc caggg gagguaguagguugugugguu    uc    gggcag g
             || ||||| |||||||||||||||||||||    ||    |||||| a
3'           gg guccc uuccgucauccaacauaucaa    ag    cccguu u
   agggacccgg  a     -                     uaga  auuc      g 
Get sequence
Deep sequencing
20974645 reads, 2.89e+05 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH002598.1: 107133-107232 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-let-7b
cgr-let-7c-2JH002598.1: 106432-106505 [+]
cgr-let-7bJH002598.1: 107133-107232 [+]
Database links

Mature sequence cgr-let-7b

Accession MIMAT0023717
Sequence

10 - 

ugagguaguagguugugugguu

 - 31

Get sequence
Deep sequencing20948206 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).