Stem-loop sequence cgr-let-7c-1

AccessionMI0020370 (change log)
DescriptionCricetulus griseus let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --------   uu   g   u             ua  g ua a 
5'         ggg  gag uag agguuguaugguu  ga u  c c
           |||  ||| ||| |||||||||||||  || |  | c
3'         ucc  uuc auc uccaacaugucaa  uu a  g c
   cacgaggu   -u   g   u             --  g gg u 
Get sequence
Deep sequencing
25706471 reads, 3.54e+05 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000146.1: 136597-136676 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-let-7c-1
cgr-mir-99aJH000146.1: 137344-137421 [-]
cgr-let-7c-1JH000146.1: 136597-136676 [-]
Database links

Mature sequence cgr-let-7c

Accession MIMAT0023718
Sequence

50 - 

cuguacaaccuucuagcuuucc

 - 71

Get sequence
Deep sequencing802 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).