Stem-loop sequence cgr-let-7d

AccessionMI0020371 (change log)
DescriptionCricetulus griseus let-7d stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ---  u       a              c      uuagggcagggauu 
5'    gc ccuagga gagguaguagguug auaguu              u
      || ||||||| |||||||||||||| ||||||               
3'    cg ggauucu uuccgucguccagc uaucaa              u
   uuc  -       -              a      uggaggaacacccg 
Get sequence
Deep sequencing
657904 reads, 7.93e+03 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000030.1: 3829137-3829231 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-let-7d
cgr-let-7a-1JH000030.1: 3831224-3831323 [-]
cgr-let-7fJH000030.1: 3830872-3830971 [-]
cgr-let-7dJH000030.1: 3829137-3829231 [-]
Database links

Mature sequence cgr-let-7d-5p

Accession MIMAT0023719
Sequence

11 - 

agagguaguagguugcauaguu

 - 32

Get sequence
Deep sequencing632154 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-let-7d-3p

Accession MIMAT0023720
Sequence

65 - 

cuauacgaccugcugccuuucu

 - 86

Get sequence
Deep sequencing3593 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).