Stem-loop sequence cgr-let-7f

AccessionMI0020372 (change log)
DescriptionCricetulus griseus let-7f stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ------   a    a ug                      ---------       u 
5'       ucu ucag g  agguaguagauuguauaguugu         gggguag g
         ||| |||| |  ||||||||||||||||||||||         ||||||| a
3'       agg aguc c  uccguuaucuaacauaucaaua         ucccauu u
   cagaug   -    - cu                      gaggacuug       u 
Get sequence
Deep sequencing
19971856 reads, 2.76e+05 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000030.1: 3830872-3830971 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-let-7f
cgr-let-7a-1JH000030.1: 3831224-3831323 [-]
cgr-let-7fJH000030.1: 3830872-3830971 [-]
cgr-let-7dJH000030.1: 3829137-3829231 [-]
Database links

Mature sequence cgr-let-7f

Accession MIMAT0023721
Sequence

11 - 

ugagguaguagauuguauaguu

 - 32

Get sequence
Deep sequencing19938766 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).