Stem-loop sequence cgr-let-7i

AccessionMI0020374 (change log)
DescriptionCricetulus griseus let-7i stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -------    u                 u   --------  u     ugu 
5'        uggc gagguaguaguuugugc guu        gg cgggu   g
          |||| ||||||||||||||||| |||        || |||||   a
3'        aucg uuccgucaucgaacgcg caa        uc gcccg   c
   ggucgug    -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
505402 reads, 6.15e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cgr-let-7i

Accession MIMAT0023724
Sequence

61 - 

cugcgcaagcuacugccuugc

 - 81

Get sequence
Deep sequencing287 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).