Stem-loop sequence cgr-mir-128

AccessionMI0020391 (change log)
DescriptionCricetulus griseus miR-128 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   ---u      uuc       uag      cu       g 
5'     guugga   ggggccg   cacugu  gagaggu u
       ||||||   |||||||   ||||||  |||||||  
3'     cgacuu   cucuggc   gugaca  cucuuua a
   ucgu      uuu       caa      --       u 
Get sequence
Deep sequencing
26737 reads, 33.3 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000082.1: 511517-511591 [+]
intergenic
Database links

Mature sequence cgr-miR-128-5p

Accession MIMAT0023749
Sequence

10 - 

cggggccguagcacugucugaga

 - 32

Get sequence
Deep sequencing152 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-128-3p

Accession MIMAT0023750
Sequence

45 - 

ucacagugaaccggucucuuu

 - 65

Get sequence
Deep sequencing2987 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).