Stem-loop sequence cgr-mir-98

AccessionMI0020563 (change log)
DescriptionCricetulus griseus miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   augcuggggugaggua           u    ---------      aggg 
5'                 guaaguuguau guug         uggggu    a
                   ||||||||||| ||||         ||||||    u
3'                 cauucaacaua caau         accccg    u
   ----------------           u    agaagaaua      gguu 
Get sequence
Deep sequencing
14608190 reads, 2.03e+05 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000201.1: 1737577-1737656 [+]
intergenic
Database links

Mature sequence cgr-miR-98

Accession MIMAT0024015
Sequence

10 - 

ugagguaguaaguuguauuguu

 - 31

Get sequence
Deep sequencing14577515 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).