Stem-loop sequence cgr-mir-99a

AccessionMI0020564 (change log)
DescriptionCricetulus griseus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -     a    a         uc   u      -  gaa 
5'  cguug caua acccguaga  cga cuugug gu   a
    ||||| |||| |||||||||  ||| |||||| ||    
3'  gugac gugu uggguaucu  gcu gaacac ca   g
   u     g    c         uc   c      g  ggu 
Get sequence
Deep sequencing
651058 reads, 8.43e+03 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000146.1: 137344-137421 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-99a
cgr-mir-99aJH000146.1: 137344-137421 [-]
cgr-let-7c-1JH000146.1: 136597-136676 [-]
Database links

Mature sequence cgr-miR-99a-5p

Accession MIMAT0024016
Sequence

11 - 

aacccguagauccgaucuugu

 - 31

Get sequence
Deep sequencing613751 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-99a-3p

Accession MIMAT0024017
Sequence

48 - 

caagcucgcuucuaugggucug

 - 69

Get sequence
Deep sequencing956 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).