Stem-loop sequence ptr-mir-655

AccessionMI0020580 (change log)
DescriptionPan troglodytes miR-655 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   uucguuucagaaauauucaag      ug           u      ua      cuuca 
5'                      gauauu  aggagagguua ccgugu  uguucg     u
                        ||||||  ||||||||||| ||||||  ||||||      
3'                      cuauaa  uuuucuccaau gguaca  auaagu     u
   --------------ucucaga      gu           u      ua      acuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86297767-86297874 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-655
ptr-mir-376cchr14: 86287939-86288003 [+]
ptr-mir-376a-2chr14: 86288317-86288395 [+]
ptr-mir-654chr14: 86288467-86288546 [+]
ptr-mir-376bchr14: 86288684-86288782 [+]
ptr-mir-376a-1chr14: 86289030-86289096 [+]
ptr-mir-300chr14: 86289611-86289692 [+]
ptr-mir-1185-1chr14: 86291220-86291304 [+]
ptr-mir-1185-2chr14: 86292441-86292525 [+]
ptr-mir-381chr14: 86294164-86294237 [+]
ptr-mir-487bchr14: 86294699-86294781 [+]
ptr-mir-539chr14: 86295556-86295632 [+]
ptr-mir-889chr14: 86296136-86296213 [+]
ptr-mir-544chr14: 86296887-86296976 [+]
ptr-mir-655chr14: 86297767-86297874 [+]
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
Database links

Mature sequence ptr-miR-655

Accession MIMAT0024033
Sequence

71 - 

auaauacaugguuaaccucuu

 - 91

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).