Stem-loop sequence ggo-let-7f

AccessionMI0020620 (change log)
DescriptionGorilla gorilla let-7f stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   aaaaca       a    a ug                      ---------       u 
5'       uugcucu ucag g  agguaguagauuguauaguugu         gggguag g
         ||||||| |||| |  ||||||||||||||||||||||         ||||||| a
3'       gaugagg aguc c  uccguuaucuaacauaucaaua         ucccauu u
   ----ca       -    - cu                      gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr9: 76195198-76195307 [+]
intergenic
Database links

Mature sequence ggo-let-7f

Accession MIMAT0024073
Sequence

21 - 

ugagguaguagauuguauagu

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).