Stem-loop sequence ggo-let-7a

AccessionMI0020621 (change log)
DescriptionGorilla gorilla let-7a stem-loop
Gene family MIPF0000002; let-7
Stem-loop
      -ccg  u   -   ug   u   gu                ---------        
5' aga    ac gcc cuu  ggg gag  aguagguuguauaguu         uggggcu 
   |||    || ||| |||  ||| |||  ||||||||||||||||         |||||| c
3' ucu    ug cgg gaa  ccu uuc  ucaucuaacauaucaa         gucccgu 
      auaa  u   u   gu   -   ug                uaggguauc        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr22: 29760609-29760717 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-let-7a
ggo-let-7achr22: 29760609-29760717 [+]
ggo-let-7bchr22: 29761546-29761654 [+]
Database links

Mature sequence ggo-let-7a

Accession MIMAT0024074
Sequence

21 - 

ugagguaguagguuguauagu

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).