Stem-loop sequence ggo-let-7c

AccessionMI0020622 (change log)
DescriptionGorilla gorilla let-7c stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -gaa   ---      a      uu   g   u             ua  g ua a 
5'     gcu   gugugc uccggg  gag uag agguuguaugguu  ga u  c c
       |||   |||||| ||||||  ||| ||| |||||||||||||  || |  | c
3'     cga   cacacg agguuc  uuc auc uccaacaugucaa  uu a  g c
   cuac   guu      -      cu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr21: 7580444-7580551 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-let-7c
ggo-mir-99achr21: 7579715-7579795 [+]
ggo-let-7cchr21: 7580444-7580551 [+]
Database links

Mature sequence ggo-let-7c

Accession MIMAT0024075
Sequence

21 - 

ugagguaguagguuguauggu

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).