Stem-loop sequence ggo-let-7b

AccessionMI0020624 (change log)
DescriptionGorilla gorilla let-7b stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   caaggcc    -  gg     u                     ----  ---a      u 
5'        gggc cu  cgggg gagguaguagguugugugguu    uc    gggcag g
          |||| ||  ||||| |||||||||||||||||||||    ||    |||||| a
3'        cccg gg  guccc uuccgucauccaacauaucaa    ag    cccguu u
   ----uga    a  -a     -                     uaga  acuc      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr22: 29761546-29761654 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-let-7b
ggo-let-7achr22: 29760609-29760717 [+]
ggo-let-7bchr22: 29761546-29761654 [+]
Database links

Mature sequence ggo-let-7b

Accession MIMAT0024077
Sequence

21 - 

ugagguaguagguuguguggu

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).