Stem-loop sequence ggo-let-7e

AccessionMI0020626 (change log)
DescriptionGorilla gorilla let-7e stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -a  -   --c    cc  c   cu   g                u  ----gga  a 
5'   cc ugc   gcgc  cc ggg  gag uaggagguuguauagu ga       gg c
     || |||   ||||  || |||  ||| |||||||||||||||| ||       ||  
3'   gg acg   cgcg  gg ccc  uuc auccuccggcauauca cu       cc a
   ag  c   ucc    uc  a   cu   g                -  agaggaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr19: 51003932-51004040 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-let-7e
ggo-let-7echr19: 51003932-51004040 [+]
ggo-mir-125achr19: 51004406-51004513 [+]
Database links

Mature sequence ggo-let-7e

Accession MIMAT0024079
Sequence

21 - 

ugagguaggagguuguauagu

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).