Stem-loop sequence ggo-mir-128

AccessionMI0020629 (change log)
DescriptionGorilla gorilla miR-128 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   ugcaauaauu    uu uuccu    u      uuc       uag      cu       u 
5'           ggcc  g     gagc guugga   ggggccg   cacugu  gagaggu u
             ||||  |     |||| ||||||   |||||||   ||||||  |||||||  
3'           ucgg  c     uucg cgacuu   cucuggc   gugaca  cucuuua a
   ----------    uc -----    u      uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr2B: 27593250-27593358 [+]
sense
ENSGGOT00000008201 ; R3HDM1-201; intron 18
ENSGGOT00000032500 ; R3HDM1-202; intron 19
Database links

Mature sequence ggo-miR-128

Accession MIMAT0024082
Sequence

71 - 

ucacagugaaccggucucuu

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).