Stem-loop sequence ggo-let-7i

AccessionMI0020630 (change log)
DescriptionGorilla gorilla let-7i stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   cccga     ug  c     u                 u   --------  u     ugu 
5'      cacca  gc cuggc gagguaguaguuugugc guu        gg cgggu   g
        |||||  || ||||| ||||||||||||||||| |||        || |||||   a
3'      guggu  cg gaucg uuccgucaucgaacgcg caa        uc gcccg   c
   -----     --  u     -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr12: 23423228-23423335 [-]
intergenic
Database links

Mature sequence ggo-let-7i

Accession MIMAT0024083
Sequence

21 - 

ugagguaguaguuugugcugu

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).