Stem-loop sequence ggo-mir-125a

AccessionMI0020680 (change log)
DescriptionGorilla gorilla miR-125a stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention ggo-mir-125a
(1 sentences)

Stem-loop
   ----------ccauguu     u u     uc  ug   c    ua        ----  a 
5'                  gccag c cuagg  cc  aga ccuu  accuguga    gg c
                    ||||| | |||||  ||  ||| ||||  ||||||||    ||  
3'                  cgguc g ggucc  gg  ucu ggag  uggacacu    cc a
   ggguccacacaccaacc     u u     ga  gu   u    --        ggga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr19: 51004406-51004513 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-125a
ggo-let-7echr19: 51003932-51004040 [+]
ggo-mir-125achr19: 51004406-51004513 [+]
Database links

Mature sequence ggo-miR-125a

Accession MIMAT0024133
Sequence

21 - 

ucccugagacccuuuaaccug

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).