Stem-loop sequence mml-mir-378d

AccessionMI0020861 (change log)
DescriptionMacaca mulatta miR-378d stem-loop
Gene family MIPF0000168; mir-378
Literature search

1 open access papers mention mml-mir-378d
(2 sentences)

Stem-loop
   gcacuuggcccagaguucacacucagggcucauugcu   au        u     -u   u  ug 
5'                                      gcc  uguuucug cuucg  ucc gu  u
                                        |||  |||||||| |||||  ||| ||  u
3'                                      ugg  acgaagac gaggu  agg ca  a
   --------------------caccucaacccuaagcu   --        u     uc   u  uu 
Get sequence
Deep sequencing
5486021 reads, 3.55e+04 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 6141470-6141581 [-]
sense
ENSMMUT00000029337 ; EVC2-201; intron 1
ENSMMUT00000029339 ; EVC2-202; intron 1
ENSMMUT00000029338 ; EVC2-203; intron 1
Database links

Mature sequence mml-miR-378d

Accession MIMAT0024313
Sequence

71 - 

acuggacuuggagucagaagca

 - 92

Get sequence
Deep sequencing5486021 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).