Stem-loop sequence mse-let-7a

AccessionMI0020986 (change log)
DescriptionManduca sexta let-7a stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   gagaga u    u    g   u   g                -a  g auuac 
5'       g gccg cggu cgg gag uaguagguuguauagu  cu c     a
         | |||| |||| ||| ||| ||||||||||||||||  || |     a
3'       c cggc gcca gcc uuc aucguccgauauguca  ga g     c
   -----g -    c    g   u   a                gg  g guuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668494.1: 417402-417503 [+]
intergenic
Clustered miRNAs
< 10kb from mse-let-7a
mse-mir-100JH668494.1: 416074-416174 [+]
mse-let-7aJH668494.1: 417402-417503 [+]
Database links

Mature sequence mse-let-7a

Accession MIMAT0024437
Sequence

22 - 

ugagguaguagguuguauag

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).