Stem-loop sequence mse-mir-100

AccessionMI0020987 (change log)
DescriptionManduca sexta miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ugu    -   ------u     cuccca       ug uc  cagcac    ccc 
5'    cgcc aac       cgcgu      gaguuug  u  ac      ccgg   c
      |||| |||       |||||      |||||||  |  ||      ||||   u
3'    gcgg uug       gcgcg      uucaagc  a  ug      gguc   u
   --c    g   cuguauu     ----ug       cu ga  -cccaa    aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Msex1.0; GCA_000262585.1) Overlapping transcripts
JH668494.1: 416074-416174 [+]
intergenic
Clustered miRNAs
< 10kb from mse-mir-100
mse-mir-100JH668494.1: 416074-416174 [+]
mse-let-7aJH668494.1: 417402-417503 [+]
Database links

Mature sequence mse-miR-100

Accession MIMAT0024438
Sequence

60 - 

aacccguagauccgaacuugug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).