Stem-loop sequence cca-MIR160b

AccessionMI0021068 (change log)
DescriptionCynara cardunculus miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention cca-MIR160b
(3 sentences)

Stem-loop
   -agc      c       c           ug  a  cg      c 
5'     auaugc uggcucc uguaugccauu  ca ag  uaucga a
       |||||| ||||||| |||||||||||  || ||  ||||||  
3'     uguacg accgagg guaugcgguag  gu uc  guagcu u
   gccu      a       c           gu  a  ug      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR160b

Accession MIMAT0024514
Sequence

7 - 

ugccuggcucccuguaugcca

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).