Stem-loop sequence cca-MIR164

AccessionMI0021069 (change log)
DescriptionCynara cardunculus miR164 stem-loop
Gene family MIPF0000045; MIR164
Literature search

4 open access papers mention cca-MIR164
(4 sentences)

Stem-loop
   -  u         a c             cg uaga     c 
5'  cu uguuggaga g aggguacgugcaa  a    aacga g
    || ||||||||| | |||||||||||||  |    |||||  
3'  ga gcaaccucu c ucucgugcacguu  u    uuguu a
   a  u         c a             au --ug     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR164

Accession MIMAT0024515
Sequence

7 - 

uggagaagcaggguacgugca

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).