Stem-loop sequence cca-MIR171

AccessionMI0021074 (change log)
DescriptionCynara cardunculus miR171 stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention cca-MIR171
(3 sentences)

Stem-loop
   -auc  a       u          c uu     u  a    uca 
5'     cg gauauug ugcgguuuaa c  accau ua ucgg   c
       || ||||||| |||||||||| |  ||||| || ||||   a
3'     gc cuauaac acgccgaguu g  uggua au agcu   a
   cugu  g       c          a uu     u  c    cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR171

Accession MIMAT0024520
Sequence

65 - 

ugauugagccgcaccaauauc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).