Stem-loop sequence cca-MIR172

AccessionMI0021075 (change log)
DescriptionCynara cardunculus miR172 stem-loop
Gene family MIPF0000035; MIR172
Literature search

2 open access papers mention cca-MIR172
(3 sentences)

Stem-loop
   ----- gc ug               a   --a     u  a 
5'      g  g  gcaucaucaagauuc cgu   caaaa gc a
        |  |  ||||||||||||||| |||   ||||| ||  
3'      c  c  cguaguaguucuaag gua   guuuu cg a
   aacgg ua gu               a   gga     u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR172

Accession MIMAT0024521
Sequence

53 - 

agaaucuugaugaugcugcau

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).