Stem-loop sequence cca-MIR395a

AccessionMI0021080 (change log)
DescriptionCynara cardunculus miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

1 open access papers mention cca-MIR395a
(1 sentences)

Stem-loop
   -cc  ca   a         -       c     u    g 
5'    cu  gag uccucccaa cacuuca uggga guuu u
      ||  ||| ||||||||| ||||||| ||||| |||| u
3'    ga  cuc agggggguu gugaagu auccu uaga c
   cgu  ac   -         u       u     u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR395a

Accession MIMAT0024526
Sequence

53 - 

uugaaguguuuggggggacuc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).