Stem-loop sequence cca-MIR395b

AccessionMI0021081 (change log)
DescriptionCynara cardunculus miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

1 open access papers mention cca-MIR395b
(1 sentences)

Stem-loop
        u c  au                    u       -   u 
5' aagug c cu  gaguuccuucgagcacuuca ugggaag cuu a
   ||||| | ||  |||||||||||||||||||| ||||||| ||| u
3' uucac g ga  cucaaggagguuugugaagu auccuuu gga u
        c u  au                    c       a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR395b

Accession MIMAT0024527
Sequence

60 - 

cugaaguguuuggaggaacuc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).