Stem-loop sequence cca-MIR395c

AccessionMI0021082 (change log)
DescriptionCynara cardunculus miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

1 open access papers mention cca-MIR395c
(1 sentences)

Stem-loop
        u c  ca   a                u     u    ug 
5' aagug c cu  gag uccuccgaacacuuca uggga guuu  u
   ||||| | ||  ||| |||||||||||||||| ||||| ||||   
3' uucgc g ga  cuc aggagguuugugaagu auccu uagg  u
        u c  ac   a                c     u    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR395c

Accession MIMAT0024528
Sequence

60 - 

cugaaguguuuggaggaacuc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).