Stem-loop sequence cca-MIR396b

AccessionMI0021084 (change log)
DescriptionCynara cardunculus miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention cca-MIR396b
(3 sentences)

Stem-loop
   --cua      c        a          aa       guacaaaaaaaa   c 
5'      ucuucc acagcuuu uugaacugca  gguuuaa            gga a
        |||||| |||||||| ||||||||||  |||||||            |||  
3'      agaagg ugucgaaa aacuugacgu  ccaaguu            ccu g
   agaca      -        g          -a       acaacuagacaa   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR396b

Accession MIMAT0024531
Sequence

7 - 

ucccacagcuuuauugaacug

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).